Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Floating mammosphere formation assay br Viable unicellula

    2020-07-31


    Floating mammosphere formation assay
    Viable unicellular suspensions of MCF-7 and MDA-MB-231 cells were plated at 5 × 103 cells/ml in Corning ultra-low adherent 6-well culture plates in 2 ml of growth medium (SFM) including serum-free DMEM-F12 (Gibco; Thermo Fisher Scientific, Inc.), supplemented with 10 ng/ml basic fibroblast growth factor (bFGF), 20 ng/ml epidermal growth factor (EGF) and B27 (all Cyagen Biosciences, Inc., Santa Clara, CA, USA). Fresh growth medium (100 µl per well) was replenished every 2 days. The number of spheres in each well was evaluated and images of representative fields were captured after 7 days of culture. Cells grown under these conditions as non-adherent spherical clusters of cells (known as mammospheres) were enzymatically dissociated every 7 days via incubation with a 0.05% trypsin-EDTA (Gibco; Thermo Fisher Scientific, Inc.) for 2 min at 37°C. The spheres were digested and passaged to the second generation for another 7 days. Then, the third generation of tumor spheres were treated with Cisplatin and varying concentrations of curcumin respectively at 37°C in an atmosphere of 5% CO2. After 4 days, mammospheres were counted and mammosphere size was evaluated by optical imaging in the absence and presence of curcumin.
    Mammosphere differentiation assay
    After measuring sphere-forming ability, mammospheres from the differentiation assay were induced by culturing sphere-derived cells for 4 days on culture dishes in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin without growth factors (serum-supplemented medium; SSM). Three days after cell passaging, the adherent cells were collected and seeded at 5 × 103 cells/ml in Corning ultra-low adherent 6-well culture plates in SFM again. Cellular morphology, differentiation capability in the Cisplatin and curcumin groups were observed.  Phytomedicine 58 (2019) 152740
    Flow cytometry
    MCF-7 and MDA-MB-231 cells were harvested 24 h after treatment with curcumin, MCF-7 and MDA-MB-231 mammospheres were treated with curcumin for 4 days separately. All of the cells were trypsinized and collected by centrifugation, washed in 2 ml PBS and resuspended in 300 µl PBS. Each type of cell suspension (at least 1,000,000 cells/ml) were divided into 5 groups including the following: (i) blank control group; (ii) FITC mouse IgG2b kappa isotype control and PE mouse IgG2a kappa isotype control; (iii) cell suspension with FITC mouse anti-human CD44; (iv) cell suspension with PE mouse anti-human CD24; and (v) cells labeled with FITC mouse anti-human CD44 and PE mouse anti-human CD24. Cells were incubated for 20 min away from light. All of the Vaborbactam were purchased from BD Biosciences. Then cells were washed in PBS, resuspended in 200 µl PBS and analyzed on a FACSCalibur system Vaborbactam (BD Biosciences). Unstained or single antibody-stained cells were analyzed for each group of cells.
    mRNA expression analysis
    Total RNA of cells was extracted and isolated using Trizol reagent (Ambion; Thermo Fisher Scientific, Inc.). Complementary DNA (cDNA) was synthesized from 1 mg total RNA via reverse-transcription poly-merase chain reaction (RT-PCR). Primer sequences for quantitative (q)-PCR were as follows: β-actin (forward: 5′ GTGGCCGAGGACTTTGATTG 3′; reverse: 5′ CCTGTAACAACGCATCTCATATT 3′); E-cadherin (for-ward: 5′ GAAACAGGATGGCTGAAGGTGAC 3′; reverse: 5′ TAAGCGAT GGCGGCATTGTA 3′); N-cadherin (forward: 5′ ATCCTACTGGACGGTT CGC 3′; reverse: 5′ CCTTGGCTAATGGCACTTG 3′); Vimentin (forward: 5′ TCTGGATTCACTCCCTCTGGT 3′; reverse: 5′ CGTGATGCTGAGAAG TTTCGT 3′); Fibronectin (forward: 5′ GTTATGGAGGAAGCCGAGGTT 3′; reverse: 5′ CATGGAGTCTTTAGGACGCTCA 3′); and β-catenin (for-ward: 5′ GTTATGGAGGAAGCCGAGGTT 3′; reverse: 5′ CATGGAGTCT TTAGGACGCTCA 3′). RT-qPCR using the 2X PCR master mix (Arraystar) was performed with the Gene Amp PCR System 9700. Expression of these genes in cancer cells were detected by standard fluorescent RT-qPCR assay in a ViiA 7 Real-time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The specificity of the pri-mers was confirmed from a single peak of a melting curve. Each target mRNA level was evaluated using the quantitative threshold cycle and were compared with the levels of β-actin as the internal control.
    Western blot analysis
    Whole cell lysates were prepared using radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) with 1 mM phenylmethylsulfonyl fluoride (Biosharp, Anhui, China). Quantitative determination of protein concentration was performed with a Bicinchoninic Acid Protein Assay Kit (Beyotime Institute of Biotechnology). A total of 50 µg of protein samples was separated by so-dium dodecyl sulfate-polyacrylamide gel electrophoresis on a 10% dena-turing gel and were transferred to a polyvinylidene difluoride (PVDF) membrane (Immobilon®-P). Then, the PVDF membrane was blocked in 5% skimmed milk for 2 h at room temperature. TBST was used to wash the membrane. The membrane was incubated with mouse monoclonal pri-mary antibodies [Nanog (1E6C4) Mouse mAb, Oct4 (9B7) Mouse mAb, Sox2 (L73B4) Mouse mAb from Cell Signaling Technology, 1:1000] and goat anti-mouse HRP secondary antibody (Abcam, 1:2000) successively. Enhanced chemiluminescence (Beyotime Institute of Biotechnology) was applied to visualize the immunoblots. The Tanon5200 Luminescence imaging system was used to analyze the protein bands.